09/07/2023
Background
Lumpy skin disease virus (L*DV) of cattle belongs to genus Capripoxvirus [family poxviridae], double-stranded DNA. It causes outbreaks in Egypt that continues since the beginning of year 2018 till present 2019. L*DV have more than one form which are antigenically distinct [non-enveloped, enveloped, intracellular mature virus, cell-associated enveloped virus, extracellular enveloped virus, intracellular enveloped virus). It impairs the innate immune system, persist in nature in wild so that it is difficult to eradicate, moreover, vaccinations always fail to control recurrent infections in endemic countries. L*D discovered in cattle in Zambia in 1929. The first outbreaks appeared in Egypt in 1988, and the disease was first reported in the Europe in Cyprus in 2014, Greece in 2015, Balkan countries in 2016 Transmission between countries occurs through movements of infected cattle or through vectors in animal trucks. All ages and breeds of cattle are susceptible. The skin lumps in cattle either regress or progress to necrosis, ulcers and finally scars. Generalized infection can affect the respiratory- tracts, digestive system, ge***alia and lymph nodes [1-7]. Negative stain EM images show that the surface membrane encloses a biconcave or cylindrical core that contains the genome DNA and proteins organized in a nucleoprotein complex. One or two lateral bodies appear to be present in the concave region between the core wall and a membrane. A recent model suggests that the nucleoprotein complex might be cylindrical, folded at least twice along the long virion axis to form a Z-structure, which presents as three circles, arranged linearly when viewed as a section across the short axis [8-10].
During the year 2018- 2019 a massive L*D enzootic was attacking Egypt, and sporadic human infections were recorded in Al Fayoum, Giza, Cairo, and Al Sharqia Governorates. Moreover, recently a laboratory acquired infection was reported (November 2019), and also in people by direct man to man transmission (November 2019). In this research the new findings focus on zoonosis of L*DV, the virus cross species barriers and the human infections are in progress and new infections were detected in persons of different communities. In human L*D apparently seen as a specific skin nodular disease, few mortalities were reported in some villagers who were in contact with infected animals. Deaths were not investigated, however, the villagers mentioned to visitor of the attacked village. This research is the first to mention that L*DV can infects human and exhibits skin lesions of various degrees, with primary localized nodules in upper of thigh, buttock, perianal areas, face, hands, with some mortalities [not investigated].
In this research, co-infection of herpes virus and L*DV was observed. Typical herpes virus particles were detected by DEM-NS on vesicle fluid, as the fragile envelopes of herpes viruses were pe*****ted by PTA stain - and reveals the stable virions cores. However, Herpes simplex is caused by two closely related viruses. Herpes Simplex Virus (HSV) type 1 and is mostly associated with oral cold sores and HSV-2 is found in ge***al lesions [11-14]. Lumpy skin disease in cattle (main host), is distinguished - by high morbidity, higher contagious spreading, cutaneous lumps, fever, lymphadenopathy, emaciation, and an illness that may persist for months in animals. Mortalities are high in young animals, and all age groups showed mortalities specially in naïve herds. Man infections with L*D are to great extent resemble the illness pathogenesis in cattle, neglected cases in human may lead to complications, as systemic infections probably happen and expected in immune compromised persons. The disease in man would studied extensively in the future [15-18].
Materials and methods
1-Biological specimens: Blood samples and infected skin specimens were collected from infected persons (10). The preliminary identification was performed by negative staining by PTA (Phosphotungestic Acid) for Transmission Electron Microscopy (TEM). The procedures were performed according to Payment, et al. [8,9,10].
2-Isolation of L*DVh: Isolation of L*DV from human samples were performed using BHK-21 [baby hamster kidney cells], and optimum temperature 38 ºC, according to Payment, et al. [8]. The isolates were kept in -80 deep freezing and given specific abbreviations; [L*DVh, 2018].
3- Convalescent anti-L*DVh positive sera: Sera samples were collected from some convalescent human subjects who completely recovered from L*DVH infections. These sera were tested by reference L*DV and showed satisfied titer of antibodies. This positive sera were useful in rapid diagnosis of new cases of L*DVh.
4- Electron microscopic examinations; Transmission EM: The procedures were performed in Cairo University. Direct electron microscopic examination by negative staining (DEM-NS) is a rapid method to demonstrate poxvirus in original unpurified biological specimens and samples by direct negative staining. Test procedures: Direct electron microscopy (DEM): The original biological specimens were re-suspended in 50 µL of phosphate-buffered saline (PBS) pH 7.2. One drop of the suspension was put on EM grid and submitted to negative staining technique with 2% potassium phosphotungstate (PTK) pH 6.4. The grids were examined and the viruses were documented in a Philips EM400-T electron microscope operating in 80 kV. All samples examined by NS-DEM. L*D virions has the characteristic morphology of poxviridae family; large, enveloped, pleomorphic, brick-shaped appearance with irregularly arranged, surface short filaments. The procedures performed [9,10].
5-Polymerase Chain Reaction (PCR) Assays: The conventional method and partial genome sequencing for ORF103 gene: Performed in reference Egyptian laboratory for animal viruses [AHRI, Dokki, Egypt].
a-Extraction of genomic DNA: The supernatant of prepared scabs samples were collected for viral DNA extraction using a Viral DNA Extraction Kit, according to manufacturer instructions and then used as a template in PCR.
b-PCR amplification: The open reading frames (ORFs) of the ORF 103 gene were amplified via PCR from DNA extracted from original samples. Primers: Target ORF103 gene for 570bp – seq. [Forward 5’ ATGTCTGATAAAAAATTATCTCG 3’] [Reverse 5’ ATCCATACCATCGTCGATAG 3’]. PCR amplification proceeded with an initial denaturation step of 94°C for 5 min followed by 35 cycles at 94°C for 1 min, 52°C for 45 s, 72°C for 1 min, and a final extension of 72°C for 10 min. Amplicons were visualized via electrophoresis on a 1.0% agarose gel and documented with a gel documentation system.
c-Cloning and DNA sequencing: The PCR products of the ORF 103 genes were then cloned. Comparison of the isolated sequences with those of Poxviridae available in the GenBank database was performed using the online Basic Local Alignment Search Tool program. Sequence identities of nucleotides between the isolated and NCBI sequences were analyzed. The nucleotide sequences deduced were assembled into a multiple sequence alignment.
Results
Nature of lumpy skin disease in human
Epidemiology: Human infections with L*DV are recorded in this research. Infected persons could be discovered in any areas where infected animals were present, so that sporadic human infections are still present and could be observed all over the country. L*D Virus is very sensitive and inactivated by glacial acetic acid, and Bee Venom. Recurrence of infection takes place without new exposure to a source of infections. All human subjects are liable to infection, however the disease showed severe forms in subjects with poor hygienic conditions, young ages and the immune compromised. The nodules responds to treatment by acyclovir drug. But nodules eruptions did not stopped by this drugs and new nodules appears in the infected persons. Person to person transmission were recorded, with apparent severe course of illness among this group of people who lives in very poor hygienic conditions. Recent infections [November 2019] were seen in persons who are living in areas were animals offal are distributed (Al Sayida Zeinab district) in Cairo, where abattoir was present. Incubation periods were in a range of one – two weeks.
The skin affections persist for months with formation of new nodules adjacent to the old ones. The nodular lesions did not respond to treatment by antibiotics, but broad-spectrum antibiotic (ceftriaxone) was helpful in combating secondary bacterial infections and showed relief of edema and inflammations. In the same patient, some nodules were showing good prognosis and disappeared without leaving scars after treatment by the oral administration of Acyclovir 1gram, topical bee venom ointment conc. 0.1%, and ascorbic acid 1% lotion. However, other skin nodules leave scars, and need months for regression. Isolation of L*DVh was achieved from patients with inflamed and active skin nodules, however the virus was detected in skin nodules and sera samples.
Clinical symptoms: First symptoms were fatigue, weight loss, fever and itching in areas were nodules would be erupting, some cases showed herpes lesions preceding the appearance of the skin nodules, these nodules were unique and never resembles abscesses (Figure 1). Symptoms of disease in some patients were aggressive, as body and legs were severely affected with numerous nodules and ulcerations. During the progress of L*D in human, the skin nodules were spreading all over the body. The painful skin lesions owned to the severe edema which developed inside the affected areas which characterize the disease in human [L*DVh].
Figure 1. L*DV infection in leg of human patients, showing severe lesions [edema, ulcers, nodules]
High body temperature degrees estimated by 38.5- 38.9 ºC, recurrence of fever occurs when new nodules appear and during its growing. Edema and swollen lymph nodes were recorded in all subjects whose showing skin nodules. Mode of skin eruptions seems to be variable from person to another, however nodules in all cases were erupted in the areas around ge***al organs. In farmers and abattoir personnel, skin nodules were mostly first seen in parts of body that handles infected materials, then were spreading to other sites in their bodies. However, some nodules developed firstly in skin of neck then spreads to other areas of body. Following fever, a sudden skin eruptions of painful, hard nodules were appear in certain and specific sites (hands, legs, face, ge***al organs, perianal regions, neck). Some cases showed eruptions of herpes virus in different parts of body, that followed by the development of large L*D nodules. The shape of L*D nodules in human were firstly appear as firm, red thickening occupy all layers of infected skin, with protruded apex and contain yellowish watery exudates that turned necrotic with the progress of disease. Since first lumps appear and occupying the entire thickness of the skin the ulcerations and formation of new nodules occurred then spreading the infections to other body parts.
Electron microscope findings analysis
L*DV and Poxviridae family morphology detection
Pox virus with characteristic morphology of capripoxviruses were detected in all examined samples (Figures 2-12). The negative stain-TEM is used in veterinary and medical virology diagnosis, with high degree of accuracy. This method allows rapid detection of poxvirus infection and very useful in differential diagnosis. DEM-NS are showing poxviruses as pleomorphic, brick-shaped, enveloped, large viruses that may reach 400 nm width. Some immature virions from aspirates of recently developed nodules were smaller in size, not enveloped and exhibiting clear short capsular filaments, however, both enveloped and non-enveloped virions are infectious. The process of poxvirus reproduction takes place inside cell cytoplasm, maturation and the addition of outer coat layers following virions release from its primary production site.
Figure 2. Human L*DV infections, skin lesion vesicular exudates showing, brick-shape virions [139-183nm in diameter]. These viral particles aggregates around an electron dense larger molecule [511 nm, width], and showing the M form and the textured surface structure of non-enveloped particle outer membrane. (Negative Staining, TEM).
Figure 3. Human L*DV infections, skin vesicular fluids showing, Lumpy Skin Disease virions. the viral particles (158 nm width) aggregates around an electron dense larger molecule, showing the M form and the textured surface structure of non-enveloped particle outer membrane and is found mainly in the vesicular fluid (Negative Staining, TEM).
Figure 4. Human L*DV infections, skin vesicular fluids showing, Lumpy Skin Disease virions. showing the M form and the textured surface structure of non-enveloped particle outer membrane and is found mainly in the vesicular fluid (Negative Staining, TEM).
